ID: 1143764822_1143764827

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1143764822 1143764827
Species Human (GRCh38) Human (GRCh38)
Location 17:9130556-9130578 17:9130595-9130617
Sequence CCCCTTAAACTCATCCACTCAGA CTTCCAGACCTGCCCTCACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 176} {0: 1, 1: 0, 2: 2, 3: 23, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!