ID: 1143770715_1143770726

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1143770715 1143770726
Species Human (GRCh38) Human (GRCh38)
Location 17:9166813-9166835 17:9166850-9166872
Sequence CCCAGACTTTACAGGGCCTGGGC ACCCATATGCTGCTGGTGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129} {0: 1, 1: 0, 2: 1, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!