ID: 1143793597_1143793599

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143793597 1143793599
Species Human (GRCh38) Human (GRCh38)
Location 17:9318005-9318027 17:9318043-9318065
Sequence CCCAATTCTTACATATGAACTCG ACACACTTGAGCAAAGTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 1, 3: 19, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!