ID: 1143794612_1143794615

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1143794612 1143794615
Species Human (GRCh38) Human (GRCh38)
Location 17:9326666-9326688 17:9326694-9326716
Sequence CCTGGTGATAAGACACTAGTGCT ATTCCAACACAGAAGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77} {0: 1, 1: 0, 2: 8, 3: 44, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!