ID: 1143854033_1143854045

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143854033 1143854045
Species Human (GRCh38) Human (GRCh38)
Location 17:9835253-9835275 17:9835289-9835311
Sequence CCCTGACCTCGTGATCCAGAATC CCTAATAGGGAGCAGATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 666} {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!