ID: 1143872774_1143872779

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143872774 1143872779
Species Human (GRCh38) Human (GRCh38)
Location 17:9969552-9969574 17:9969584-9969606
Sequence CCACTTTCTACCTGGGGGCAGAA AGCCACCTGGACTCCCATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209} {0: 1, 1: 0, 2: 1, 3: 8, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!