ID: 1143877973_1143877980

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1143877973 1143877980
Species Human (GRCh38) Human (GRCh38)
Location 17:10007261-10007283 17:10007314-10007336
Sequence CCGAGGTATTTCTGACACCCACC TAACCAAGACGTCTAAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 146} {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!