ID: 1143897130_1143897140

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1143897130 1143897140
Species Human (GRCh38) Human (GRCh38)
Location 17:10145103-10145125 17:10145147-10145169
Sequence CCAACAGAAATCCACAGCCCCAC GCTCAGGGCTGCAGACGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 276} {0: 1, 1: 0, 2: 6, 3: 38, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!