|
Left Crispr |
Right Crispr |
| Crispr ID |
1143900089 |
1143900097 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:10167809-10167831
|
17:10167839-10167861
|
| Sequence |
CCACCTGGGCCTCCCGAGTAGCT |
CAGGCATGCACCACCATGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 210, 2: 7956, 3: 41130, 4: 60043} |
{0: 4351, 1: 14696, 2: 43750, 3: 92278, 4: 164583} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|