ID: 1143924118_1143924122

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1143924118 1143924122
Species Human (GRCh38) Human (GRCh38)
Location 17:10354688-10354710 17:10354725-10354747
Sequence CCAGCAGTTCTTCACTGTCATCG GACCTCTCCTTGGCTCACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103} {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!