ID: 1143924121_1143924129

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1143924121 1143924129
Species Human (GRCh38) Human (GRCh38)
Location 17:10354721-10354743 17:10354739-10354761
Sequence CCGTGACCTCTCCTTGGCTCACG TCACGAAGGGGAAGTCGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 195} {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!