ID: 1143924461_1143924470

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1143924461 1143924470
Species Human (GRCh38) Human (GRCh38)
Location 17:10357566-10357588 17:10357603-10357625
Sequence CCTTCCTCAAAGTGTATCACAAT GATTGATCTCAATCACTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185} {0: 1, 1: 0, 2: 0, 3: 10, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!