ID: 1143959680_1143959682

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1143959680 1143959682
Species Human (GRCh38) Human (GRCh38)
Location 17:10705661-10705683 17:10705713-10705735
Sequence CCTTCTCACATGGATTGGTTACA TTAAATGCCTATTTTAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139} {0: 1, 1: 1, 2: 7, 3: 102, 4: 777}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!