ID: 1143996822_1143996826

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1143996822 1143996826
Species Human (GRCh38) Human (GRCh38)
Location 17:11013659-11013681 17:11013674-11013696
Sequence CCCCAGCTGCATCTCCACAGCTG CACAGCTGCCACATTAAAGAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 56, 4: 439} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!