ID: 1144037616_1144037626

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144037616 1144037626
Species Human (GRCh38) Human (GRCh38)
Location 17:11381681-11381703 17:11381731-11381753
Sequence CCATCAGAGCCACATGAAGGTGA CACTGCTGCTGGGGGCATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 192} {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!