ID: 1144037709_1144037715

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1144037709 1144037715
Species Human (GRCh38) Human (GRCh38)
Location 17:11382320-11382342 17:11382334-11382356
Sequence CCTTCCACCTTCCCCTCCCAAAG CTCCCAAAGTGCTGAGTTTATGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 1699, 3: 31018, 4: 113679} {0: 3, 1: 315, 2: 4837, 3: 5080, 4: 5471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!