|
Left Crispr |
Right Crispr |
| Crispr ID |
1144037709 |
1144037716 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:11382320-11382342
|
17:11382335-11382357
|
| Sequence |
CCTTCCACCTTCCCCTCCCAAAG |
TCCCAAAGTGCTGAGTTTATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 1699, 3: 31018, 4: 113679} |
{0: 14, 1: 2298, 2: 49333, 3: 340688, 4: 241398} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|