ID: 1144047433_1144047437

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144047433 1144047437
Species Human (GRCh38) Human (GRCh38)
Location 17:11466467-11466489 17:11466495-11466517
Sequence CCTTTTGCCATGGAAGGTAACTT CACACTTCAGGGACATCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 136, 3: 465, 4: 1062} {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!