ID: 1144051485_1144051488

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144051485 1144051488
Species Human (GRCh38) Human (GRCh38)
Location 17:11500787-11500809 17:11500800-11500822
Sequence CCCATCATCTCAGAAAGTGCTAT AAAGTGCTATTGGACATAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 221} {0: 1, 1: 0, 2: 2, 3: 22, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!