ID: 1144051486_1144051489

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1144051486 1144051489
Species Human (GRCh38) Human (GRCh38)
Location 17:11500788-11500810 17:11500807-11500829
Sequence CCATCATCTCAGAAAGTGCTATT TATTGGACATAGATGGATTATGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 63, 3: 247, 4: 726} {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!