ID: 1144067330_1144067333

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1144067330 1144067333
Species Human (GRCh38) Human (GRCh38)
Location 17:11636360-11636382 17:11636384-11636406
Sequence CCTTTGTTTATTGGTTTATCCAG TTCTTATGCCAAGTAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 264} {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!