ID: 1144069073_1144069081

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144069073 1144069081
Species Human (GRCh38) Human (GRCh38)
Location 17:11651126-11651148 17:11651176-11651198
Sequence CCTGAGACAGCAGCAGCCATGTT TGTGGCTAATTTAGAGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 304} {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!