ID: 1144073815_1144073818

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1144073815 1144073818
Species Human (GRCh38) Human (GRCh38)
Location 17:11699442-11699464 17:11699472-11699494
Sequence CCTATCTATAGTAGACCAATCCA TCAAACCATTGTGACTTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 0, 3: 4, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!