ID: 1144092667_1144092680

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1144092667 1144092680
Species Human (GRCh38) Human (GRCh38)
Location 17:11871962-11871984 17:11871999-11872021
Sequence CCCACTGCCCTCCAGGCCACCTG CCTCTGAATGTAGTCCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 490} {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!