ID: 1144099030_1144099036

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144099030 1144099036
Species Human (GRCh38) Human (GRCh38)
Location 17:11927787-11927809 17:11927813-11927835
Sequence CCCATCAACCCTGTGGGGCAGCC AGGATCTCTGAATCCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164} {0: 1, 1: 0, 2: 0, 3: 20, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!