ID: 1144107224_1144107241

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1144107224 1144107241
Species Human (GRCh38) Human (GRCh38)
Location 17:11997233-11997255 17:11997284-11997306
Sequence CCACGGTCCACTCCCAGCCATGG CCCGCGCGCTCCCAGACGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 232} {0: 1, 1: 0, 2: 1, 3: 9, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!