ID: 1144107236_1144107251

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1144107236 1144107251
Species Human (GRCh38) Human (GRCh38)
Location 17:11997267-11997289 17:11997318-11997340
Sequence CCGCACTCGCCACGTCCCCCGCG CGCTGGCCCCTCCGTAGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140} {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!