ID: 1144126241_1144126247

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1144126241 1144126247
Species Human (GRCh38) Human (GRCh38)
Location 17:12205570-12205592 17:12205610-12205632
Sequence CCTGGGATGATGTGAGAAGGCTT TTGAACTGGGCCTTAAAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 9, 3: 77, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!