ID: 1144194648_1144194650

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144194648 1144194650
Species Human (GRCh38) Human (GRCh38)
Location 17:12878658-12878680 17:12878679-12878701
Sequence CCATAGGTCAGGCCTTCACTAAT ATGCTCTGCTGAAGTGCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111} {0: 1, 1: 0, 2: 0, 3: 18, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!