ID: 1144206709_1144206721

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1144206709 1144206721
Species Human (GRCh38) Human (GRCh38)
Location 17:12984642-12984664 17:12984676-12984698
Sequence CCAGCACCCCGTCACCCTATGGA TCAGGGGTACTCCTTGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 86} {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!