ID: 1144227397_1144227401 |
View in Genome Browser |
Spacer: 4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1144227397 | 1144227401 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 17:13162948-13162970 | 17:13162975-13162997 |
| Sequence | CCAACTAGCATTTTAGATAACCA | TTTAAAGAAGGTGACAAAAAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 3, 3: 54, 4: 672} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||