ID: 1144227397_1144227403

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144227397 1144227403
Species Human (GRCh38) Human (GRCh38)
Location 17:13162948-13162970 17:13162990-13163012
Sequence CCAACTAGCATTTTAGATAACCA AAAAAGGGAAAAATGCACCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 60, 4: 645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!