ID: 1144244057_1144244068

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144244057 1144244068
Species Human (GRCh38) Human (GRCh38)
Location 17:13345819-13345841 17:13345871-13345893
Sequence CCCAGAAAATACTGCAGTGAGTG CAGGGTGAAGAGAAGGGGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 133, 4: 1454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!