ID: 1144262531_1144262533

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1144262531 1144262533
Species Human (GRCh38) Human (GRCh38)
Location 17:13536578-13536600 17:13536601-13536623
Sequence CCATTAATGTTGCTAACTGACCA CGCCCACGTTTAACACCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 122} {0: 1, 1: 0, 2: 0, 3: 3, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!