ID: 1144282168_1144282170

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1144282168 1144282170
Species Human (GRCh38) Human (GRCh38)
Location 17:13736986-13737008 17:13737033-13737055
Sequence CCAGAAAGGACAGTTTACTGTTC TGTGAATCAGCAGAAGCCTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!