ID: 1144290808_1144290815

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1144290808 1144290815
Species Human (GRCh38) Human (GRCh38)
Location 17:13824470-13824492 17:13824506-13824528
Sequence CCCTGAACCACATGGGGATTTGG CATGCAGATCATAGTGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 86, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!