ID: 1144333628_1144333633

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144333628 1144333633
Species Human (GRCh38) Human (GRCh38)
Location 17:14248764-14248786 17:14248777-14248799
Sequence CCTCCCACCTTCTTCTTGGTTAC TCTTGGTTACTAGTTATCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!