ID: 1144339741_1144339752

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1144339741 1144339752
Species Human (GRCh38) Human (GRCh38)
Location 17:14301673-14301695 17:14301697-14301719
Sequence CCGGCTCCTGCGCCGCCGCGCCG GGCTGCTGCTCCTGGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 370} {0: 1, 1: 1, 2: 6, 3: 69, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!