ID: 1144413752_1144413758

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144413752 1144413758
Species Human (GRCh38) Human (GRCh38)
Location 17:15025817-15025839 17:15025869-15025891
Sequence CCCTCTTTGCTTTGAGTCACCCG GGCTCCTATGAGCAGTCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!