ID: 1144445089_1144445091

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1144445089 1144445091
Species Human (GRCh38) Human (GRCh38)
Location 17:15319719-15319741 17:15319739-15319761
Sequence CCTCTCTACTGGACCACACACGT CGTTGCCTTTTGATGCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73} {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!