ID: 1144457073_1144457079

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1144457073 1144457079
Species Human (GRCh38) Human (GRCh38)
Location 17:15427698-15427720 17:15427716-15427738
Sequence CCCCCACCACCATGCACATAGGT TAGGTTTCTAAAGAACCTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!