ID: 1144473057_1144473061

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1144473057 1144473061
Species Human (GRCh38) Human (GRCh38)
Location 17:15561710-15561732 17:15561754-15561776
Sequence CCTGGGCGCAGGTTCAAATGTCA CTCCATCTTCAATAGGAGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 3, 4: 80} {0: 5, 1: 323, 2: 745, 3: 735, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!