ID: 1144478812_1144478818

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1144478812 1144478818
Species Human (GRCh38) Human (GRCh38)
Location 17:15612180-15612202 17:15612209-15612231
Sequence CCATCCAACACATGAGTAAAGCA AAGAAGAGGAAGTGTCGGGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 173} {0: 1, 1: 0, 2: 0, 3: 34, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!