ID: 1144490541_1144490554

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144490541 1144490554
Species Human (GRCh38) Human (GRCh38)
Location 17:15704701-15704723 17:15704753-15704775
Sequence CCCAGCAGGAGTTTCATGCGGAA GGCCCTCGATGGTGACCTGGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 74} {0: 2, 1: 0, 2: 0, 3: 8, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!