ID: 1144501069_1144501080

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144501069 1144501080
Species Human (GRCh38) Human (GRCh38)
Location 17:15786866-15786888 17:15786918-15786940
Sequence CCGTGATGGGGCCGGAGCTGGGC CTCCTCTGATTCCTTCAACGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 8, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!