ID: 1144515986_1144516000

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144515986 1144516000
Species Human (GRCh38) Human (GRCh38)
Location 17:15917810-15917832 17:15917860-15917882
Sequence CCTACTCGGCTCCTTGGCTTAGG ACCCCAAACTTCGCCTGTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!