ID: 1144519696_1144519702

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1144519696 1144519702
Species Human (GRCh38) Human (GRCh38)
Location 17:15945493-15945515 17:15945542-15945564
Sequence CCTGCTTCGTGCTGGTGCTCACG CGTGGCAGTCGACAGATACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112} {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!