ID: 1144543993_1144543996

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1144543993 1144543996
Species Human (GRCh38) Human (GRCh38)
Location 17:16175290-16175312 17:16175324-16175346
Sequence CCCAGGCAGAGGTTGCAGTGAGT CACTGCACAACACAACAGTCTGG
Strand - +
Off-target summary {0: 5, 1: 86, 2: 161, 3: 337, 4: 815} {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!