ID: 1144576619_1144576629

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1144576619 1144576629
Species Human (GRCh38) Human (GRCh38)
Location 17:16433747-16433769 17:16433770-16433792
Sequence CCCTGGGGCCCCCCTGCAGTGCA GGGCACAGCTGCCAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 239} {0: 1, 1: 0, 2: 6, 3: 84, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!