ID: 1144578360_1144578367

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1144578360 1144578367
Species Human (GRCh38) Human (GRCh38)
Location 17:16443890-16443912 17:16443912-16443934
Sequence CCCGGGTCAACCGGTTGCCATTG GAGTGCCAGTGTGGTGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 44} {0: 1, 1: 0, 2: 3, 3: 26, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!